This must be hidden

Роль коллагенопатий в развитии пролапса гениталий и недержания мочи у женщин

23.08.2018
821
0

Д.А. Вишневский1, Г.Р. Касян1, Л.В. Акуленко2, Шарова Е.И. 3, Тупикина Н.В. 1, Пушкарь Д.Ю. 1
1 Кафедра урологии (зав. – член-корр. РАН, проф. Д. Ю. Пушкарь) ФГБОУ ВО ≪Московский государственный медико-стоматологический университет им. А. И. Евдокимова≫ МЗ РФ, Москва, Россия
2 Кафедра медицинской генетики (зав. – проф. Л.В. Акуленко) ФГБОУ ВО ≪Московский государственный медико-стоматологический университет им. А. И. Евдокимова≫ МЗ РФ, Москва, Россия
3 Федеральное государственное бюджетное учреждение «Федеральный научно-клинический центр физико-химической медицины Федерального медико-биологического агентства» (ФГБУ ФНКЦ ФХМ ФМБА России)

Пролапс тазовых органов (ПТО) и недержание мочи при напряжении (НМ) являются распространенными патологиями у женщин. В России ПТО составляет до 39% от всей гинекологической патологии [1]. Также около 38,6% российских женщин отмечают симптомы непроизвольного выделения мочи [2]. Таким образом, столь широкая распространенность данных патологий представляет собой не только медицинскую, но и социальную проблему.

Однако единого мнения об этиологии и патогенезе ПТО и НМ на сегодняшний день не существует. Считается, что ПТО и НМ являются патологией многофакторной природы, развитие которой происходит в результате генетической предрасположенности, реализующейся в определенных условиях внешней среды [3].

К факторам внешней среды относятся: травматичные и длительные роды, эстроген-дефицитные состояния, заболевания, сопровождающиеся повышением внутрибрюшного давления (бронхит, бронхиальная астма, запоры и др.), нарушение процессов микроциркуляции крови и лимфы в малом тазу, ожирение, малоподвижный образ жизни [4,5].

В мировой литературе описано большое количество семейных случаев ПТО и НМ, что дало основание предполагать генетическую предрасположенность к данным состояниям [6]. Существует мнение, что ПТО и НМ обусловлены генетически детерминированными изменениями соединительной ткани. Поэтому главная роль в поиске генетической предрасположенности отводится генетическим факторам, обуславливающим патологию соединительной ткани. Как известно, при ПТО и НМ имеют значение коллагеновые белки, которые входят в состав связок, поддерживающих органы тазового дна в нормальном положении. Таковыми являются коллагеновые белки I и III типов [7].

Рассматривая ПТО и НМ как следствие дисплазии соединительной ткани, мы объединили эти две патологии в одну нозологию – дисфункция тазового дна (ДТД).

В формировании генетической предрасположенности к ДТД играет роль полиморфизм rs1800255 в гене COL3A1, которая остается неясной. Так K.B. Kluivers и соавт., исследуя ассоциацию данного полиморфизма с ПТО, выявили наличие взаимосвязи между вышеуказанной патологией и носительством полиморфизма rs1800255 в гене COL3A1 [8]. Похожие результаты были получены и H.Y. Chen и соавт. [9]. Однако в исследовании, проведенном S.L. Lince и соавт. на большом материале (354 женщины с ПТО), ассоциация данного гомозиготного полиморфизма с ДТД не была выявлена [10].

Предварительное исследование на кафедре урологии МГМСУ на небольшой выборке женщин (52 женщины – группа исследования и 21 женщина – группа контроля) выявило корреляцию между полиморфизмом rs1800255 в гене COL3A1 и ДТД, что стало основанием для продолжения исследования на более значительной выборке пациенток [11]

Данные по исследованию полиморфизма rs 1800012 гена COL1A1 также являются весьма противоречивым. Так, мета-анализ, проведенный R.M. Ward и соавт., не подтвердил связи данного полиморфизма с ПТО [12]. Однако исследования H.J. Cho и соавт. все же не позволят исключить наличие такой взаимосвязи [13].

Указанные противоречия в данных разных авторов относительно ассоциации полиморфизмов rs1800255 и rs 1800012 с развитием ДТД побудило нас к проведению настоящего исследования.

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

В исследовании участвовали 250 женщин, которые с января по сентябрь 2017 года проходили лечение в урологических отделениях клиники урологии МГМСУ.

В группу исследования были включены 150 пациенток с верифицированным диагнозом ПТО и (или) НМ. Из них 34 пациентки страдали ПТО, 53 пациентки – НМ и 63 пациентки – ПТО и НМ. Все пациентки находились в возрасте от 40 до 70 лет (средний возраст 65±2 года).

В группу контроля были включены пациентки без дисфункции тазового дна, находившиеся в урологической клинике в связи с другими заболеваниями (мочекаменная болезнь, острый пиелонефрит, цистит и др.). Пациентки контрольной группы были подобраны методом «случай-контроль» к пациенткам исследуемой группы в соответствии с возрастом. Средний возраст пациенток контрольной группы составил 64,9±2 года.

Пациентки обеих групп имели один иди несколько внешне-средовых факторов риска, например, двое или более родов через естественные родовые пути, травматические роды, роды плодом более 4000 г., чрезмерная физическая активность, заболевания, сопровождающиеся увеличением абдоминального давления (бронхиальная астма, хронический бронхит, хронический запор), наличие операций на органах малого таза.

Критериями исключения пациенток из обеих групп являлись наследственные синдромы Марфана и Элерса–Данлоса.

Все 250 пациенток дали письменное согласие на участие в исследовании.

Перед проведением исследования нами было получено одобрение университетского этического комитета (протокол № 05-17).

В качестве биологического материала для генотипирования у всех участниц исследования собиралась слюна в стерильную пластиковую пробирку. Перед сдачей биологических образцов слюны все пациентки воздерживались от приема пищи, жидкости, курения не менее 1 часа. Непосредственно перед сдачей слюны пациентки жевали слизистую щеки в течение 5-10 секунд, затем собирали 3-4 мл слюны в стерильную пробирку. Пробирки нумеровались и замораживались до последующей транспортировки в лабораторию.

ЛАБОРАТОРНОЕ ИССЛЕДОВАНИЕ

Реализация дизайна праймеров и генотипирование пациенток исследуемой и контрольной групп проводилось в молекулярно-генетической лаборатории ФГБУ ФНКЦ ФХМ ФМБА России с использованием он-лайн системы Primer-BLAST и метода секвенирования по Сэнгеру соответственно [14].

Полиморфизм rs1800255 в гене COL3A1 является локальной мутацией в последовательности ДНК – замещением гуанина (G) на аденин (А). Для изучения данного полиморфизма были созданы два праймера – на ~200-350 bp выше по положению и ~200–350 bp ниже необходимого положения для амплификации фрагмента 400–700 bp. Специфичность праймеров подтверждена ПЦР с последующим электрофорезом в агарозном геле. Последовательность продукта секвенирования ПЦР выполнена на ABI 3730XL (Life Technologies) с одного конца, по одной реакции шаблоном поABI. Конечными праймерами являлись fTAGTTCCCACCCAGCTGTTCи rACCTTGTCACCCTTTGGACC.

Полиморфизм rs1800012 в гене COL1A1 также является локальной мутацией в последовательности ДНК – замещением гуанина (G) на тимин (Т). Для генотипирования по Сэнгеру на этот маркер была подобрана следующая пара праймеров: прямой праймер Col1A1f1 AAGACCCGGGTTATTGCTGG и обратный праймер Col1A1r1 ACTCCAACCTCAGCCCATTG. Проверка специфичности показала, что пара неплоха и неспецифичных коротких продуктов не ожидается.

СТАТИСТИЧЕСКИЙ АНАЛИЗ

Данные генотипирования были подвергнуты статистической обработке при помощи программы PASW Statistics 22.

Описательные статистики представлялись в виде среднего и стандартного отклонения, медианы и 25-го и 75-го процентилей, минимального и максимального значений в выборке для количественных переменных, а также частот встречаемости и долей в выборке для качественных переменных.

Для сравнения количественных данных в двух несвязанных между собой выборках применялся U-критерий Манна-Уитни. Для сравнения номинальных переменных в двух несвязанных совокупностях использовался точный критерий Фишера. Уровень значимости (p) принимали равным 0,05 во всех сравнениях.

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ

В исследовании приняло участие 250 пациенток, проходивших лечение в клинике урологии МГМСУ. 150 пациенток, имеющие ПТО и/или НМ, вошли в группу исследования. Эти пациентки в возрасте от 40 до 70 лет (средний возраст 65±2 года) имели как минимум один внешний фактор риска (двое или более родов через естественные родовые пути, травматические роды, роды плодом более 4000 г., чрезмерная физическая активность, заболевания, сопровождающиеся увеличением абдоминального давления (бронхиальная астма, хронический бронхит, хронический запор), наличие операций на органах малого таза).

В группу контроля вошли 100 пациенток без дисфункции тазового дна в возрасте от 40 до 70 лет (средний возраст 64,9±2 года). Эти пациентки имели те же внешние факторы риска что и пациентки группы исследования.

Распределение внешних факторов риска в группах отражено в таблице 1.

Таблица 1. Распределение внешних факторов риска в группах исследования и контроля

Показатель Наличие Группа исследования Группа контроля
    Чел. % Чел. %
Ожирение нет
есть
116
34
77.3
22.7
86
14
86.0
14.0
Операции на органах малого таза нет
есть
110
40
73.3
26.7
74
26
74.0
26.0
Бронхиты, запоры нет
есть
82
68
54.7
45.3
44
56
44.0
56.0
Менопауза нет
есть
35
115
23.3
76.7
29
71
29.0
71.0
Тяжелая работа нет
есть
94
56
62.7
37.3
58
42
58.0
42.0
Роды 2 и более нет
есть
56
94
37.3
62.7
36
64
36.0
64.0
Травматичные роды нет
есть
72
78
48.0
52.0
59
41
59.0
41.0

Все генетические варианты, изученные в рамках настоящей работы, находились в состоянии равновесия по Харди – Вайнбергу.

Результаты генотипирования для полиморфизма rs 1800255 в гене COL3A1 отражены в таблице 2, а результаты генотипирования полиморфизма rs1800012 – в таблице 3.

Данные генотипирования были подвергнуты статистическому анализу. Статистический анализ не выявил различий между группой исследования и группой контроля.

Таким образом, проведенное исследование не подтверждает ассоциацию полиморфизмов rs 18000255 в гене COL3A1 и rs180002 в гене COL1A1 с дисфункцией тазового дна.

Таблица 2. Результаты генотипирования полиморфизма rs1800255 в гене COL3A1

Группа Генотип
GG чел. (%) GA чел. (%) AA чел. (%)
Исследования 90 (60) 50 (33,3) 10 (6,7)
Контроля 64 (64) 28 (28,0) 8 (8,0)

Таблица 3. Результаты генотипирования полиморфизма rs1800012 в гене COL1A1

Группа Генотип
CC чел. (%) СA чел. (%) AA чел. (%)
Исследования 108 (72,0) 39 (26,0) 3 (2,0)
Контроля 68 (68,0) 31 (31,0) 1(1,0)

ОБСУЖДЕНИЕ И ВЫВОДЫ

Предыдущие работы, посвященные изучению влияния исследуемых в настоящей работе полиморфизмов на дисфункцию тазового дна, не дали однозначного ответа. Так, в работе K.B. Kluivers и соавт. показана ассоциация полиморфизма rs1800255 в гене COL3A1 с ПТО [8]. Такие же результаты были полученыв исследовании H.Y.Chen и соавт. [9]. Исследование же S.L. Lince и соавт. на большой выборке ассоциацию полиморфизма rs1800255 в гене COL3A1 не выявило [10].

Предварительное исследование, проведенное на кафедре урологии МГМСУ, на небольшой выборке пациенток, показало, что полиморфизм rs1800255 в гене COL3A1 вероятно является фактором риска развития ДТД у женщин [11].

Роль полиморфизма rs1800012 в гене COL1A1 в предрасположенности к развитию ПТО также не была ясна. Так, мета-анализ, проведанный R.M. Ward и соавт., включавший исследования на бразильской, израильской, итальянской и польской популяциях, не подтвердил связи данного полиморфизма с ПТО [12]. Однако исследования H.J.Cho и соавт. не позволили нам исключить наличие ассоциации данного полиморфизма с ДТД у женщин [13].

Вероятное объяснение таких различий заключается в том, что эти исследования проводились на разных этнических популяциях и использовались различные методы детекции полиморфизмов.

Настоящее исследование было выполнено с целью выяснения связи ПТО и НМ с носительством полиморфизмов rs1800255 в гене COL3A1 и rs1800012 в гене COL1A1 с помощью генотипирования образцов слюны пациенток исследуемой и контрольной группы методом секвенирования по Сэнгеру. Секвенирование по Сэнгеру в настоящее время является золотым стандартом в генотипировании одиночных полиморфизмов, поэтому именно этот метод был выбран для проведения данного исследования [14].

Генотипирование пациенток группы исследования (150 человек) и группы контроля (100 человек) и последующий статистический анализ не выявило ассоциацию полиморфизмов rs1800255 в гене COL3A1 и. rs1800012 в гене COL1A1 с дисфункцией тазового дна.

Таким образом, полиморфизмы rs1800255 в гене COL3A1 и rs1800012 в генеCOL1A1 не участвуют в формировании предрасположенности к ПТО и НМ. Дальнейшие исследования этих полиморфизмов не представляются целесообразными.

ЛИТЕРАТУРА

  1. Адамян Л.В., Смольнова Т.Ю., Сидоров В.В. Лазерная допплеровская флоуметрия в изучении состояния микроциркуляторного русла у больных с опухолевыми заболеваниями гениталий. Вопросы гинекологии, акушерства и перинатологии 2006;(5):34-39.
  2.  Аполихина И.А., Адикян В.М. Эпидемиологические аспекты недержания мочи. Журнал Российского общества акушеровгинекологов. 2005;1:12.
  3. Акуленко Л.В., Касян Г.Р., Козлова Ю.О., Тупикина Н.В., Вишневский Д.А., Пушкарь Д.Ю. Дисфункция тазового дна у женщин в аспекте генетических исследований. Урология 2017;(1)76-81
  4. Lowder JL, Frankman EA, Ghetti C, Burrows LJ, Krohn MA, Moalli P, Zyczynski H. Lower urinary tract symptoms in women with pelvic organ prolapse. Int Urogynecol J. 2010;21(6):665–672.
  5. Krissi H, Halperin R, Koren P, Peled Y. The presence and location of estrogen and progesterone receptors in the human pelvic cardinal ligaments. Pelviperineology. 2010;29:17-19.
  6. Chiaffarino F, Chatenoud L, Dindelli M, Meschia M, Buonaguidi A., Amicarelli F, et al. Reproductive factors, family history, occupation and risk of urogenital prolapse. Eur J Obstet Gynecol Reprod Biol 1999;82(1):63-67.
  7. Lim VF, Khoo JK, Wong V, Moore KH Recent studies of genetic dysfunction in pelvic organ prolapse: the role of collagen defects. Aust N Z J Obstet Gynaecol 2014;54(3):198-205.
  8. Kluivers KB, Dijkstra JR, Hendriks JC, et al. COL3A1 2209 G>A is a predictor of pelvic organ prolapse. Int Urogynecol J Pelvic Floor Dysfunct 2009;20(9):1113–1118
  9. Chen HY, Chung YW, Lin WY et al. Collagen type 3 alpha 1 polymorphism and risk of pelvic organ prolapse. Int J Gynaecol Obstet 2008;103(1):55-58
  10. Lince SL, van Kempen LC, Vierhout ME et al. A systematic review of clinical studies on hereditary factors in pelvic organ pro-lapse. Int Urogynecol J 2012;23(10):1327-1336
  11. Касян Г.Р., Вишневский Д.А., Акуленко Л.В., Козлова Ю.О., Шарова Е.И., Тупикина Н.В., Пушкарь Д.Ю. Ассоциация полиморфизма 1800255 гена COL3A1 с развитием пролапса тазовых органов и недержания мочи у женщин. Урология 2017;(6):30-33
  12. Ward R.M., Velez Edwards D.R., Edwards T., Giri A., Jerome R.N., Wu J.M. Genetic epidemiology of pelvic organ prolapse: a systematic review. Am J Obstet Gynecol. 2014;211(4):326-35.
  13. Cho HJ, Jung HJ, Kim SK, Choi JR, Cho NH, Bai SW Polymorphism of a COLIA1 gene Sp1 binding site in Korean women with pelvic organ prolapse. Yonsei Med J. 2009;50(4):564-8. doi: 10.3349/ ymj.2009.50.4.564.
  14. Sanger F; Coulson AR. A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase. J Mol Biol 1975;94(3): 441–8.

Статья опубликована в журнале"Экспериментальная и клиническая урология" №2 2018, стр.113-117

Тематики и теги

Комментарии

Журнал "Экспериментальная и клиническая урология" Выпуск №2, 2018
Журнал "Экспериментальная и клиническая урология" Выпуск №2, 2018
Выпуски